| | <!DOCTYPE html> |
| | <html lang="en"> |
| | <head> |
| | <meta charset="UTF-8"> |
| | <meta name="viewport" content="width=device-width, initial-scale=1.0"> |
| | <title>Genomic Sequence Search</title> |
| | <link rel="preconnect" href="https://fonts.googleapis.com"> |
| | <link rel="preconnect" href="https://fonts.gstatic.com" crossorigin> |
| | <link href="https://fonts.googleapis.com/css2?family=JetBrains+Mono:wght@400;500;600&family=Outfit:wght@300;400;500;600;700&display=swap" rel="stylesheet"> |
| | <style> |
| | :root { |
| | --bg-primary: #0a0a0b; |
| | --bg-secondary: #111113; |
| | --bg-tertiary: #18181b; |
| | --bg-hover: #1f1f23; |
| | --border: #27272a; |
| | --border-focus: #3f3f46; |
| | --text-primary: #fafafa; |
| | --text-secondary: #a1a1aa; |
| | --text-muted: #71717a; |
| | --accent: #10b981; |
| | --accent-dim: #059669; |
| | --accent-glow: rgba(16, 185, 129, 0.15); |
| | --dna-a: #22d3ee; |
| | --dna-t: #f472b6; |
| | --dna-c: #a78bfa; |
| | --dna-g: #fbbf24; |
| | --success: #4ade80; |
| | --error: #f87171; |
| | --gradient-1: linear-gradient(135deg, #10b981 0%, #22d3ee 100%); |
| | --radius-sm: 6px; |
| | --radius-md: 10px; |
| | --radius-lg: 16px; |
| | } |
| | |
| | * { |
| | margin: 0; |
| | padding: 0; |
| | box-sizing: border-box; |
| | } |
| | |
| | body { |
| | font-family: 'Outfit', -apple-system, BlinkMacSystemFont, sans-serif; |
| | background: var(--bg-primary); |
| | color: var(--text-primary); |
| | min-height: 100vh; |
| | line-height: 1.6; |
| | } |
| | |
| | body::before { |
| | content: ''; |
| | position: fixed; |
| | top: 0; |
| | left: 0; |
| | right: 0; |
| | bottom: 0; |
| | background-image: |
| | linear-gradient(rgba(16, 185, 129, 0.03) 1px, transparent 1px), |
| | linear-gradient(90deg, rgba(16, 185, 129, 0.03) 1px, transparent 1px); |
| | background-size: 40px 40px; |
| | pointer-events: none; |
| | z-index: 0; |
| | } |
| | |
| | .container { |
| | max-width: 1000px; |
| | margin: 0 auto; |
| | padding: 2rem; |
| | position: relative; |
| | z-index: 1; |
| | } |
| | |
| | header { |
| | text-align: center; |
| | padding: 2rem 0 1.5rem; |
| | } |
| | |
| | .logo { |
| | display: inline-flex; |
| | align-items: center; |
| | gap: 0.75rem; |
| | margin-bottom: 0.75rem; |
| | } |
| | |
| | .logo-icon { |
| | width: 52px; |
| | height: 52px; |
| | background: var(--gradient-1); |
| | border-radius: var(--radius-md); |
| | display: flex; |
| | align-items: center; |
| | justify-content: center; |
| | font-size: 1.75rem; |
| | } |
| | |
| | h1 { |
| | font-size: 2.25rem; |
| | font-weight: 600; |
| | letter-spacing: -0.03em; |
| | background: var(--gradient-1); |
| | -webkit-background-clip: text; |
| | -webkit-text-fill-color: transparent; |
| | background-clip: text; |
| | } |
| | |
| | .subtitle { |
| | color: var(--text-secondary); |
| | font-size: 1rem; |
| | font-weight: 300; |
| | margin-top: 0.25rem; |
| | } |
| | |
| | .stats-bar { |
| | display: flex; |
| | justify-content: center; |
| | gap: 2.5rem; |
| | padding: 1rem 0; |
| | margin-bottom: 1.5rem; |
| | border-bottom: 1px solid var(--border); |
| | } |
| | |
| | .stat { |
| | text-align: center; |
| | } |
| | |
| | .stat-value { |
| | font-family: 'JetBrains Mono', monospace; |
| | font-size: 1.25rem; |
| | font-weight: 500; |
| | color: var(--accent); |
| | } |
| | |
| | .stat-label { |
| | font-size: 0.7rem; |
| | color: var(--text-muted); |
| | text-transform: uppercase; |
| | letter-spacing: 0.08em; |
| | margin-top: 0.2rem; |
| | } |
| | |
| | .search-section { |
| | background: var(--bg-secondary); |
| | border: 1px solid var(--border); |
| | border-radius: var(--radius-lg); |
| | padding: 1.5rem; |
| | margin-bottom: 1.5rem; |
| | } |
| | |
| | .search-label { |
| | display: block; |
| | font-size: 0.85rem; |
| | font-weight: 500; |
| | color: var(--text-secondary); |
| | margin-bottom: 0.75rem; |
| | } |
| | |
| | .search-textarea { |
| | width: 100%; |
| | min-height: 120px; |
| | padding: 1rem; |
| | font-family: 'JetBrains Mono', monospace; |
| | font-size: 0.9rem; |
| | background: var(--bg-primary); |
| | border: 1px solid var(--border); |
| | border-radius: var(--radius-md); |
| | color: var(--text-primary); |
| | resize: vertical; |
| | transition: all 0.2s ease; |
| | line-height: 1.6; |
| | } |
| | |
| | .search-textarea:focus { |
| | outline: none; |
| | border-color: var(--accent); |
| | box-shadow: 0 0 0 3px var(--accent-glow); |
| | } |
| | |
| | .search-textarea::placeholder { |
| | color: var(--text-muted); |
| | } |
| | |
| | .search-controls { |
| | display: flex; |
| | justify-content: space-between; |
| | align-items: center; |
| | margin-top: 1rem; |
| | gap: 1rem; |
| | } |
| | |
| | .char-count { |
| | font-family: 'JetBrains Mono', monospace; |
| | font-size: 0.8rem; |
| | color: var(--text-muted); |
| | } |
| | |
| | .search-actions { |
| | display: flex; |
| | gap: 0.75rem; |
| | align-items: center; |
| | } |
| | |
| | .top-k-select { |
| | padding: 0.6rem 0.75rem; |
| | background: var(--bg-tertiary); |
| | border: 1px solid var(--border); |
| | border-radius: var(--radius-sm); |
| | color: var(--text-primary); |
| | font-family: inherit; |
| | font-size: 0.85rem; |
| | cursor: pointer; |
| | } |
| | |
| | .search-btn { |
| | padding: 0.75rem 2rem; |
| | background: var(--gradient-1); |
| | border: none; |
| | border-radius: var(--radius-md); |
| | color: var(--bg-primary); |
| | font-family: inherit; |
| | font-size: 0.95rem; |
| | font-weight: 600; |
| | cursor: pointer; |
| | transition: all 0.2s ease; |
| | } |
| | |
| | .search-btn:hover { |
| | opacity: 0.9; |
| | transform: scale(1.02); |
| | } |
| | |
| | .search-btn:disabled { |
| | opacity: 0.5; |
| | cursor: not-allowed; |
| | transform: none; |
| | } |
| | |
| | .clear-btn { |
| | padding: 0.6rem 1rem; |
| | background: transparent; |
| | border: 1px solid var(--border); |
| | border-radius: var(--radius-sm); |
| | color: var(--text-secondary); |
| | font-family: inherit; |
| | font-size: 0.85rem; |
| | cursor: pointer; |
| | transition: all 0.2s ease; |
| | } |
| | |
| | .clear-btn:hover { |
| | border-color: var(--border-focus); |
| | color: var(--text-primary); |
| | } |
| | |
| | .results-container { |
| | margin-top: 1rem; |
| | } |
| | |
| | .results-header { |
| | display: flex; |
| | justify-content: space-between; |
| | align-items: center; |
| | margin-bottom: 1rem; |
| | padding-bottom: 0.75rem; |
| | border-bottom: 1px solid var(--border); |
| | } |
| | |
| | .results-count { |
| | color: var(--text-secondary); |
| | font-size: 0.9rem; |
| | } |
| | |
| | .results-count strong { |
| | color: var(--text-primary); |
| | } |
| | |
| | .result-card { |
| | background: var(--bg-secondary); |
| | border: 1px solid var(--border); |
| | border-radius: var(--radius-md); |
| | padding: 1.25rem; |
| | margin-bottom: 0.75rem; |
| | transition: all 0.2s ease; |
| | animation: slideIn 0.3s ease forwards; |
| | opacity: 0; |
| | transform: translateY(10px); |
| | } |
| | |
| | .result-card:hover { |
| | border-color: var(--border-focus); |
| | background: var(--bg-tertiary); |
| | } |
| | |
| | @keyframes slideIn { |
| | to { |
| | opacity: 1; |
| | transform: translateY(0); |
| | } |
| | } |
| | |
| | .result-header { |
| | display: flex; |
| | justify-content: space-between; |
| | align-items: center; |
| | margin-bottom: 0.75rem; |
| | } |
| | |
| | .result-rank { |
| | display: inline-flex; |
| | align-items: center; |
| | justify-content: center; |
| | width: 32px; |
| | height: 32px; |
| | background: var(--bg-primary); |
| | border-radius: var(--radius-sm); |
| | font-family: 'JetBrains Mono', monospace; |
| | font-size: 0.85rem; |
| | font-weight: 600; |
| | color: var(--text-secondary); |
| | } |
| | |
| | .result-rank.top-3 { |
| | background: var(--accent-glow); |
| | color: var(--accent); |
| | } |
| | |
| | .result-score { |
| | font-family: 'JetBrains Mono', monospace; |
| | font-size: 0.85rem; |
| | color: var(--accent); |
| | background: var(--accent-glow); |
| | padding: 0.3rem 0.85rem; |
| | border-radius: var(--radius-sm); |
| | } |
| | |
| | .result-sequence { |
| | font-family: 'JetBrains Mono', monospace; |
| | font-size: 0.85rem; |
| | color: var(--text-primary); |
| | background: var(--bg-primary); |
| | padding: 0.85rem 1rem; |
| | border-radius: var(--radius-sm); |
| | margin-bottom: 0.75rem; |
| | word-break: break-all; |
| | line-height: 1.7; |
| | max-height: 120px; |
| | overflow-y: auto; |
| | letter-spacing: 0.5px; |
| | } |
| | |
| | .result-metadata { |
| | display: flex; |
| | flex-wrap: wrap; |
| | gap: 0.5rem; |
| | } |
| | |
| | .metadata-tag { |
| | display: inline-flex; |
| | align-items: center; |
| | gap: 0.4rem; |
| | padding: 0.35rem 0.75rem; |
| | background: var(--bg-primary); |
| | border-radius: var(--radius-sm); |
| | font-size: 0.8rem; |
| | } |
| | |
| | .metadata-key { |
| | color: var(--text-muted); |
| | } |
| | |
| | .metadata-value { |
| | color: var(--text-secondary); |
| | font-family: 'JetBrains Mono', monospace; |
| | max-width: 200px; |
| | overflow: hidden; |
| | text-overflow: ellipsis; |
| | white-space: nowrap; |
| | } |
| | |
| | .loading { |
| | display: flex; |
| | flex-direction: column; |
| | align-items: center; |
| | justify-content: center; |
| | gap: 1rem; |
| | padding: 3rem; |
| | color: var(--text-secondary); |
| | } |
| | |
| | .spinner { |
| | width: 32px; |
| | height: 32px; |
| | border: 3px solid var(--border); |
| | border-top-color: var(--accent); |
| | border-radius: 50%; |
| | animation: spin 0.8s linear infinite; |
| | } |
| | |
| | @keyframes spin { |
| | to { transform: rotate(360deg); } |
| | } |
| | |
| | .message { |
| | padding: 1rem 1.25rem; |
| | border-radius: var(--radius-md); |
| | margin-bottom: 1rem; |
| | font-size: 0.9rem; |
| | } |
| | |
| | .message.error { |
| | background: rgba(248, 113, 113, 0.1); |
| | border: 1px solid rgba(248, 113, 113, 0.2); |
| | color: var(--error); |
| | } |
| | |
| | .message.info { |
| | background: rgba(16, 185, 129, 0.1); |
| | border: 1px solid rgba(16, 185, 129, 0.2); |
| | color: var(--accent); |
| | } |
| | |
| | .empty-state { |
| | text-align: center; |
| | padding: 4rem 2rem; |
| | color: var(--text-muted); |
| | } |
| | |
| | .empty-state-icon { |
| | font-size: 3.5rem; |
| | margin-bottom: 1rem; |
| | opacity: 0.4; |
| | } |
| | |
| | .empty-state p { |
| | font-size: 1rem; |
| | } |
| | |
| | .example-queries { |
| | margin-top: 1.5rem; |
| | } |
| | |
| | .example-queries h4 { |
| | font-size: 0.8rem; |
| | color: var(--text-muted); |
| | text-transform: uppercase; |
| | letter-spacing: 0.05em; |
| | margin-bottom: 0.75rem; |
| | } |
| | |
| | .example-btn { |
| | display: inline-block; |
| | padding: 0.5rem 1rem; |
| | margin: 0.25rem; |
| | background: var(--bg-tertiary); |
| | border: 1px solid var(--border); |
| | border-radius: var(--radius-sm); |
| | color: var(--text-secondary); |
| | font-family: 'JetBrains Mono', monospace; |
| | font-size: 0.75rem; |
| | cursor: pointer; |
| | transition: all 0.2s ease; |
| | } |
| | |
| | .example-btn:hover { |
| | border-color: var(--accent); |
| | color: var(--accent); |
| | } |
| | |
| | @media (max-width: 640px) { |
| | .container { |
| | padding: 1rem; |
| | } |
| | |
| | h1 { |
| | font-size: 1.5rem; |
| | } |
| | |
| | .stats-bar { |
| | gap: 1.5rem; |
| | } |
| | |
| | .search-controls { |
| | flex-direction: column; |
| | align-items: stretch; |
| | } |
| | |
| | .search-actions { |
| | justify-content: space-between; |
| | } |
| | } |
| | </style> |
| | </head> |
| | <body> |
| | <div class="container"> |
| | <header> |
| | <div class="logo"> |
| | <div class="logo-icon">🧬</div> |
| | </div> |
| | <h1>Genomic Sequence Search</h1> |
| | <p class="subtitle">Find similar sequences using transformer embeddings</p> |
| | </header> |
| |
|
| | <div class="stats-bar"> |
| | <div class="stat"> |
| | <div class="stat-value" id="doc-count">—</div> |
| | <div class="stat-label">Sequences</div> |
| | </div> |
| | <div class="stat"> |
| | <div class="stat-value" id="dim-count">—</div> |
| | <div class="stat-label">Dimensions</div> |
| | </div> |
| | <div class="stat"> |
| | <div class="stat-value" id="device-info">—</div> |
| | <div class="stat-label">Device</div> |
| | </div> |
| | </div> |
| |
|
| | <div id="message-container"></div> |
| |
|
| | <div class="search-section"> |
| | <label class="search-label">Enter a genomic sequence to search:</label> |
| | <textarea |
| | class="search-textarea" |
| | id="search-input" |
| | placeholder="Paste your genomic sequence here (e.g., ATCGATCGATCG...)" |
| | spellcheck="false" |
| | ></textarea> |
| | <div class="search-controls"> |
| | <span class="char-count"><span id="char-count">0</span> characters</span> |
| | <div class="search-actions"> |
| | <button class="clear-btn" onclick="clearSearch()">Clear</button> |
| | <select class="top-k-select" id="top-k"> |
| | <option value="5">Top 5</option> |
| | <option value="10" selected>Top 10</option> |
| | <option value="20">Top 20</option> |
| | <option value="50">Top 50</option> |
| | </select> |
| | <button class="search-btn" id="search-btn" onclick="search()"> |
| | Search |
| | </button> |
| | </div> |
| | </div> |
| | </div> |
| |
|
| | <div class="results-container" id="results-container"> |
| | <div class="empty-state"> |
| | <div class="empty-state-icon">🔬</div> |
| | <p>Enter a sequence above to find similar matches</p> |
| | <div class="example-queries"> |
| | <h4>Try an example</h4> |
| | <button class="example-btn" onclick="loadExample('ATCGATCGATCGATCGATCG')">ATCGATCG...</button> |
| | <button class="example-btn" onclick="loadExample('GCTAGCTAGCTAGCTAGCTA')">GCTAGCTA...</button> |
| | <button class="example-btn" onclick="loadExample('AAAATTTTCCCCGGGGAAAA')">AAAATTTT...</button> |
| | </div> |
| | </div> |
| | </div> |
| | </div> |
| |
|
| | <script> |
| | const API_BASE = ''; |
| | |
| | document.addEventListener('DOMContentLoaded', () => { |
| | loadStats(); |
| | |
| | const input = document.getElementById('search-input'); |
| | input.addEventListener('input', updateCharCount); |
| | input.addEventListener('keydown', (e) => { |
| | if (e.key === 'Enter' && e.ctrlKey) { |
| | search(); |
| | } |
| | }); |
| | }); |
| | |
| | async function loadStats() { |
| | try { |
| | const res = await fetch(`${API_BASE}/api/stats`); |
| | if (res.ok) { |
| | const data = await res.json(); |
| | document.getElementById('doc-count').textContent = data.total_documents.toLocaleString(); |
| | document.getElementById('dim-count').textContent = data.embedding_dimension; |
| | document.getElementById('device-info').textContent = data.device.toUpperCase(); |
| | } |
| | } catch (e) { |
| | console.log('Could not load stats:', e); |
| | } |
| | } |
| | |
| | function updateCharCount() { |
| | const count = document.getElementById('search-input').value.length; |
| | document.getElementById('char-count').textContent = count.toLocaleString(); |
| | } |
| | |
| | function clearSearch() { |
| | document.getElementById('search-input').value = ''; |
| | updateCharCount(); |
| | document.getElementById('results-container').innerHTML = ` |
| | <div class="empty-state"> |
| | <div class="empty-state-icon">🔬</div> |
| | <p>Enter a sequence above to find similar matches</p> |
| | <div class="example-queries"> |
| | <h4>Try an example</h4> |
| | <button class="example-btn" onclick="loadExample('ATCGATCGATCGATCGATCG')">ATCGATCG...</button> |
| | <button class="example-btn" onclick="loadExample('GCTAGCTAGCTAGCTAGCTA')">GCTAGCTA...</button> |
| | <button class="example-btn" onclick="loadExample('AAAATTTTCCCCGGGGAAAA')">AAAATTTT...</button> |
| | </div> |
| | </div> |
| | `; |
| | } |
| | |
| | function loadExample(seq) { |
| | document.getElementById('search-input').value = seq; |
| | updateCharCount(); |
| | search(); |
| | } |
| | |
| | async function search() { |
| | const query = document.getElementById('search-input').value.trim(); |
| | if (!query) { |
| | showMessage('Please enter a sequence to search', 'error'); |
| | return; |
| | } |
| | |
| | const topK = parseInt(document.getElementById('top-k').value); |
| | const container = document.getElementById('results-container'); |
| | const searchBtn = document.getElementById('search-btn'); |
| | |
| | container.innerHTML = ` |
| | <div class="loading"> |
| | <div class="spinner"></div> |
| | <span>Encoding sequence and searching...</span> |
| | </div> |
| | `; |
| | searchBtn.disabled = true; |
| | |
| | try { |
| | const res = await fetch(`${API_BASE}/api/search`, { |
| | method: 'POST', |
| | headers: { 'Content-Type': 'application/json' }, |
| | body: JSON.stringify({ query, top_k: topK }) |
| | }); |
| | |
| | const data = await res.json(); |
| | |
| | if (!res.ok) { |
| | container.innerHTML = `<div class="message error">${data.detail}</div>`; |
| | return; |
| | } |
| | |
| | if (data.results.length === 0) { |
| | container.innerHTML = ` |
| | <div class="empty-state"> |
| | <div class="empty-state-icon">🤷</div> |
| | <p>No similar sequences found</p> |
| | </div> |
| | `; |
| | return; |
| | } |
| | |
| | container.innerHTML = ` |
| | <div class="results-header"> |
| | <span class="results-count">Found <strong>${data.results.length}</strong> similar sequences</span> |
| | <span class="results-count">from ${data.total_indexed.toLocaleString()} indexed</span> |
| | </div> |
| | ${data.results.map((r, i) => ` |
| | <div class="result-card" style="animation-delay: ${i * 0.04}s"> |
| | <div class="result-header"> |
| | <span class="result-rank ${r.rank <= 3 ? 'top-3' : ''}">${r.rank}</span> |
| | <span class="result-score">${(r.score * 100).toFixed(2)}%</span> |
| | </div> |
| | <div class="result-sequence">${escapeHtml(r.sequence)}</div> |
| | <div class="result-metadata"> |
| | ${Object.entries(r.metadata) |
| | .filter(([k]) => !k.startsWith('__')) |
| | .slice(0, 8) |
| | .map(([k, v]) => ` |
| | <span class="metadata-tag"> |
| | <span class="metadata-key">${escapeHtml(k)}:</span> |
| | <span class="metadata-value" title="${escapeHtml(String(v))}">${escapeHtml(String(v).slice(0, 50))}</span> |
| | </span> |
| | `).join('')} |
| | </div> |
| | </div> |
| | `).join('')} |
| | `; |
| | } catch (e) { |
| | container.innerHTML = `<div class="message error">Search failed: ${e.message}</div>`; |
| | } finally { |
| | searchBtn.disabled = false; |
| | } |
| | } |
| | |
| | function showMessage(text, type = 'info') { |
| | const container = document.getElementById('message-container'); |
| | container.innerHTML = `<div class="message ${type}">${text}</div>`; |
| | setTimeout(() => container.innerHTML = '', 4000); |
| | } |
| | |
| | function escapeHtml(text) { |
| | const div = document.createElement('div'); |
| | div.textContent = text; |
| | return div.innerHTML; |
| | } |
| | </script> |
| | </body> |
| | </html> |
